| Details for Substrate
c-fos sis inducible element (hSIE) without Explicit Binding Affinity Data |
| Binding Enzyme 1: | Signal transducer and activator of transcription 3 |
| Binding Enzyme 2: | Signal transducer and activator of transcription 1-alpha/beta |
| Binding Enzyme 3: | Signal transducer and activator of transcription 1-alpha/beta/3 |
| Synonyms: |
32P-labeled c-fos sis inducible element (hSIE)
|
| Type: | Oligonucleotide |
| Topology: | Linear |
| Mol. Mass.: | 2192.56 Dalton |
| Organism: | n/a |
| Description: | hSIE derived from the c-fos gene promoter. |
| Residue: | 24 |
| Sequence: | AGCTTCATTTCCCGTAAATCCCTA |
| |