Compile Data Set for Download or QSAR
Report error Found 58 Enz. Inhib. hit(s) with all data for entry = 50020829
TargetIntegrase(Human immunodeficiency virus type 1)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50123468BDBM50123468([3-Benzyl-5-(1,1-dioxo-1lambda 6 -isothiazolidin-2...)
Affinity DataIC50: 10nMAssay Description:Inhibition of HIV-1 integrase DTG-resistant R263K mutantMore data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetIntegrase(Human immunodeficiency virus type 1)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 23400BDBM23400((2Z)-4-(3-benzylphenyl)-2-hydroxy-4-oxobut-2-enoic...)
Affinity DataIC50: 10nMAssay Description:Inhibition of HIV-1 integrase DTG-resistant R263K mutantMore data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetIntegrase(Human immunodeficiency virus type 1)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 25351BDBM25351(N-[2-(4-{[(4-fluorophenyl)methyl]carbamoyl}-5-hydr...)
Affinity DataIC50: 15nMAssay Description:Inhibition of HIV-1 integrase strand transfer activityMore data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetIntegrase(Human immunodeficiency virus type 1)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 25351BDBM25351(N-[2-(4-{[(4-fluorophenyl)methyl]carbamoyl}-5-hydr...)
Affinity DataIC50: 15nMAssay Description:Inhibition of HIV-1 integrase G140S/Q148K double mutantMore data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetIntegrase(Human immunodeficiency virus type 1)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 28236BDBM28236(CHEMBL199145 | N-[(4-fluorophenyl)methyl]-8-hydrox...)
Affinity DataIC50: 33nMAssay Description:Inhibition of HIV-1 integrase DTG-resistant R263K mutantMore data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50633925BDBM50633925(CHEMBL5405971)
Affinity DataIC50: 40nMAssay Description:Inhibition of HIV-1 reverse transcriptaseMore data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50633918BDBM50633918(CHEMBL5435292)
Affinity DataIC50: 100nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50633919BDBM50633919(CHEMBL5394678)
Affinity DataIC50: 220nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50633917BDBM50633917(CHEMBL5400428)
Affinity DataIC50: 300nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50157832BDBM50157832(3-Hydroxy-4a,7a-dihydro-1H-thieno[2,3-d]pyrimidine...)
Affinity DataIC50: 400nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50633914BDBM50633914(CHEMBL5426420)
Affinity DataIC50: 480nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50157834BDBM50157834(3-Hydroxy-6-phenyl-1H-thieno[3,2-d]pyrimidine-2,4-...)
Affinity DataIC50: 600nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetIntegrase(Human immunodeficiency virus type 1)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50123472BDBM50123472(7-Benzyl-1,2-dihydroxy-xanthen-9-one | CHEMBL28809...)
Affinity DataIC50: 600nMAssay Description:Inhibition of HIV-1 integrase DTG-resistant R263K mutantMore data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604819BDBM50604819(CHEMBL204900)
Affinity DataIC50: 620nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50633915BDBM50633915(CHEMBL5422734)
Affinity DataIC50: 680nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50533378BDBM50533378(CHEMBL4440667)
Affinity DataIC50: 740nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50157854BDBM50157854(5,6-Dibutyl-3-hydroxy-1H-thieno[2,3-d]pyrimidine-2...)
Affinity DataIC50: 790nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50633920BDBM50633920(CHEMBL5399934)
Affinity DataIC50: 940nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604838BDBM50604838(CHEMBL5172238)
Affinity DataIC50: 1.00E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50633916BDBM50633916(CHEMBL5406945)
Affinity DataIC50: 1.10E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50533405BDBM50533405(CHEMBL4550191)
Affinity DataIC50: 1.10E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50468792BDBM50468792(CHEMBL4280869)
Affinity DataIC50: 1.20E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50633913BDBM50633913(CHEMBL5418937)
Affinity DataIC50: 1.40E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50278490BDBM50278490(CHEMBL4161705)
Affinity DataIC50: 1.60E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50633921BDBM50633921(CHEMBL5416503)
Affinity DataIC50: 1.80E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50533401BDBM50533401(CHEMBL4445181)
Affinity DataIC50: 2.20E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetRNA-directed RNA polymerase(Hepatitis C virus genotype 1b (isolate Con1) (HCV))
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50147498BDBM50147498(3-Hydroxy-4-oxo-4H-pyran-2,6-dicarboxylic acid 6-e...)
Affinity DataIC50: 2.25E+3nMAssay Description:Inhibition of Hepatitis C virus NS5B polymeraseMore data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50533377BDBM50533377(CHEMBL4475877)
Affinity DataIC50: 2.30E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50485905BDBM50485905(CHEMBL2180589)
Affinity DataIC50: 2.40E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50633926BDBM50633926(CHEMBL5421863)
Affinity DataIC50: 2.50E+3nMAssay Description:Inhibition of HIV-1 RNase H polymerase activityMore data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50604819BDBM50604819(CHEMBL204900)
Affinity DataIC50: 2.50E+3nMAssay Description:Inhibition of HIV-1 reverse transcriptase RNase HMore data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetRNA-directed RNA polymerase(Hepatitis C virus genotype 1b (isolate Con1) (HCV))
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50153250BDBM50153250(5,6-Dihydroxy-2-thiophen-2-yl-pyrimidine-4-carboxy...)
Affinity DataIC50: 2.60E+3nMAssay Description:Inhibition of Hepatitis C virus NS5B polymeraseMore data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetIntegrase(Human immunodeficiency virus type 1)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50476539BDBM50476539(CHEMBL437708)
Affinity DataIC50: 2.60E+3nMAssay Description:Inhibition of HIV-1 integrase G140S/Q148K double mutantMore data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50633922BDBM50633922(CHEMBL5417834)
Affinity DataIC50: 2.80E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50533367BDBM50533367(CHEMBL4461191)
Affinity DataIC50: 2.90E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50633924BDBM50633924(CHEMBL5434901)
Affinity DataIC50: 4.50E+3nMAssay Description:Inhibition of human Cytomegalovirus C-terminal UL89More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50633926BDBM50633926(CHEMBL5421863)
Affinity DataIC50: 5.40E+3nMAssay Description:Inhibition of HIV-1 reverse transcriptase associated RNA-dependent DNA polymeraseMore data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetRNA-directed RNA polymerase(Hepatitis C virus genotype 1b (isolate Con1) (HCV))
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50115579BDBM50115579(CHEMBL16326 | (Z)-2-hydroxy-4-oxo-4-phenyl-but-2-e...)
Affinity DataIC50: 5.70E+3nMAssay Description:Inhibition of Hepatitis C virus NS5B polymeraseMore data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50182040BDBM50182040(CHEMBL3819579)
Affinity DataIC50: 6.00E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50571837BDBM50571837(CHEMBL4848335)
Affinity DataIC50: 6.20E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50278505BDBM50278505(CHEMBL4159305 | US11253521, No. 15)
Affinity DataIC50: 6.40E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50182033BDBM50182033(CHEMBL3818878)
Affinity DataIC50: 8.00E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50533354BDBM50533354(CHEMBL4455962)
Affinity DataIC50: 9.30E+3nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50533372BDBM50533372(CHEMBL4454510)
Affinity DataIC50: 1.40E+4nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50182030BDBM50182030(CHEMBL3818730)
Affinity DataIC50: 1.40E+4nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50533361BDBM50533361(CHEMBL4451895)
Affinity DataIC50: 1.40E+4nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50468846BDBM50468846(CHEMBL4291913)
Affinity DataIC50: 2.00E+4nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50533358BDBM50533358(CHEMBL4466948)
Affinity DataIC50: 2.00E+4nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50533399BDBM50533399(CHEMBL4586421)
Affinity DataIC50: 2.00E+4nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
TargetTripartite terminase subunit 3(HHV-5)
University of Minnesota

Curated by ChEMBL
LigandChemical structure of BindingDB Monomer ID 50533411BDBM50533411(CHEMBL4450408)
Affinity DataIC50: 2.00E+4nMAssay Description:Inhibition of Human Cytomegalovirus C-terminal UL89 phosphorylation using (5-tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcga as a substr...More data for this Ligand-Target Pair
In Depth
Date in BDB:
12/22/2024
Entry Details
PubMed
Displayed 1 to 50 (of 58 total ) | Next | Last >>
Jump to: