Report error Found 250 Enz. Inhib. hit(s) with all data for entry = 50009908
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 100nMAssay Description:Inhibition of re-constituted HIV1 reverse transcriptase RNase H domain fragmentMore data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 150nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 150nMAssay Description:Inhibition of re-constituted HIV1 reverse transcriptase RNase H domain fragmentMore data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 150nMAssay Description:Inhibition of re-constituted HIV1 reverse transcriptase RNase H domain fragmentMore data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 180nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 190nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 200nMAssay Description:Inhibition of re-constituted HIV1 reverse transcriptase RNase H domain fragmentMore data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 200nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 200nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 220nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 220nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 240nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 250nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 250nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in DNA 3'-end cleavage using HTS2 substrat...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 250nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 250nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 300nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in DNA 3'-end cleavage using HTS2 substrat...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 300nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 300nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 300nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in DNA 3'-end cleavage using HTS2 substrat...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 300nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in DNA 3'-end cleavage using HTS2 substrat...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 310nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 320nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in DNA 3'-end cleavage using HTS2 substrat...More data for this Ligand-Target Pair
TargetReverse transcriptase(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 340nMAssay Description:Inhibition of polymerase activity of HIV1 reverse transcriptase using poly(rA)-oligo(dT)16 and [3H]-TTP incubated for 20 mins by liquid scintillation...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 370nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 370nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 380nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS...More data for this Ligand-Target Pair
Affinity DataIC50: 400nMAssay Description:Inhibition of HIV integrase pre-incubated for 10 mins before addition of oligo-5'-biotin ATGTGGAAAATCTCTAGCA annealed with ACTGCTAGAGATTTTCCACAT 3'-C...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 400nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 400nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 400nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 400nMAssay Description:Inhibition of re-constituted HIV1 reverse transcriptase RNase H domain fragmentMore data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 400nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 430nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in DNA 3'-end cleavage using HTS2 substrat...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 440nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 450nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in DNA 3'-end cleavage using HTS2 substrat...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 450nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in DNA 3'-end cleavage using HTS2 substrat...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 450nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in DNA 3'-end cleavage using HTS2 substrat...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 460nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 470nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 470nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 490nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in DNA 3'-end cleavage using HTS2 substrat...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 500nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 500nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 500nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 510nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 540nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in DNA 3'-end cleavage using HTS2 substrat...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 600nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 600nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in RNA 5'-end directed cleavage using HTS3...More data for this Ligand-Target Pair
TargetReverse transcriptase/RNaseH(Human immunodeficiency virus type 1)
University of Minnesota
Curated by ChEMBL
University of Minnesota
Curated by ChEMBL
Affinity DataIC50: 600nMAssay Description:Inhibition of RNase H activity of full length recombinant HIV1 reverse transcriptase assessed as reduction in nonspecific internal cleavage using HTS...More data for this Ligand-Target Pair



















